Tuesday, March 2, 2010

Uh-oh! It's crime busting time!

The last part of the project became intense!
The sheet/assignment read:
"A heinous crime has been commited in the world of imaginary creatures- somebody blasphemed that the Easter Bunny was not real! Fortunately, a bit of DNA was left behind with the evidence."

So I had to create a complementary DNA sequence that is 50 base pairs long to be submitted to government for evidence.

AGCTTTCGACTGACAACGTTTAGACACGTAGACTAGAGACTTTTAGATATA

TCGAAAGCTGACTGTTGCAAATCTGTGCATCTGATCTCTGAAAATCTATAT

If I am not guilty of the crime, then my DNA fingerprint will not match the suspects!